Target (protein/gene name): 6-phosphoglucanate dehydrogenase (gnd)

*NCBI Gene # or RefSeq#:


*Protein ID (NP or XP #) or Wolbachia#:

*Organism (including strain): L. monocytogenes
Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)

Etiologic Risk Group (see link below): Category B Priority (NIAID)

*Disease Information:

Listeriosis is a foodborne illness caused by infection with the bacterium Listeria monocytogenes. With a 21% case-fatality rate between 2009 and 2011 in the United States, listeriosis is the third highest cause of death of the major foodborne pathogens. Listeriosis is especially serious in unborn babies, newborn infants, pregnant women, elderly, and those with immunocompromised conditions and can result in fatal complications including miscarriages, septicemia, and meningitis. Listeria infection can result from eating unpasteurized milk products, raw produce, raw seafood, or improperly processed meat. Symptoms of listeriosis begin with fever, nausea, and diarrhea and progress to headaches, confusion, loss of balance, and convulsions. If symptoms persist and in high-risk patients, listeriosis is treated with ampicillin, often in combination with gentamicin, with the length of treatment varying by case. --Stolen from another page

Link to TDR Targets page (if present): Here

Link to Gene Database page (NCBI, EuPath databases -e.g. TryTryp, PlasmoDB, etc - or PATRIC, etc.) Here

Essentiality of this protein:

Is it a monomer or multimer as biological unit? (make prediction at http://www.ebi.ac.uk/msd-srv/prot_int/pistart.html):

Complex of proteins?:

Druggable Target (list number or cite evidence from a paper/database showing druggable in another organism):
http://jb.asm.org/content/194/3/663.full
http://mbio.asm.org/content/6/3/e00253-15.full


*EC#: 1.1.1.44
Link to BRENDA EC# page: http://www.brenda-enzymes.org/php/result_flat.php4?ecno=1.1.1.44
Screen Shot 2013-04-28 at 9.38.18 PM.png
Screen Shot 2013-04-28 at 9.38.18 PM.png



Enzyme Assay information (spectrophotometric, coupled assay ?, reagents): reagents
-- link to Sigma (or other company) page for assay or assay reagents (substrates)
http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Sigma/Enzyme_Assay/6phosphoglucdehydro74.pdf
-- link (or citation) to paper that contains assay information
http://www.brenda-enzymes.info/literature/lit.php4?e=1.1.1.44&r=656470
-- List cost and quantity of substrate reagents and supplier
phosphogluconic acid SIGMA P7877 - $75 for 100mg


Structure (PDB or Homology model)
-- PDB # or closest PDB entry if using homology model: 5G1Q, 5G1R
---- Show pairwise alignment of your BLASTP search in NCBI against the PDB

AlignmentClpP.png
AlignmentClpP.png

---- Query Coverage: 1st chain---- Max % Identities: 56%
---- % Positives: 75%
---- Chain used for homology:

>5G1Q:A|PDBID|CHAIN|SEQUENCE

MITNNLVPTVIEKTAGGERAFDIYSRLLKERIVFLNGEVNDHSANLVIAQLLFLESEDPDKDIYFYINSPGGMVTAGMGVYDTMQFIKPDVSTICIGLAASMGSLLLAGGAKGKRYSLPSSQIMIHQPLGGFRGQASDIEIHAKNILRIKDRLNKVLAHHTGQDLETIVKDTDRDNFMMADEAKAYGLIDHVIESREAIIK




Current Inhibitors: Beta-lactone D3, Beta-lactone U1, Beta-lactone 7, Phenyl Ester AV170
Expression Information (has it been expressed in bacterial cells): Expressed in E. coli Bl21 (DE3)
Purification Method: Ni affinity Chromatography
Image of protein (PyMol with features delineated and shown separately):
5G1Q.jpg
5G1Q.jpg

*Amino Acid Sequence:

>5G1Q:A|PDBID|CHAIN|SEQUENCE
MITNNLVPTVIEKTAGGERAFDIYSRLLKERIVFLNGEVNDHSANLVIAQLLFLESEDPDKDIYFYINSPGGMVTAGMGVYDTMQFIKPDVSTICIGLAASMGSLLLAGGAKGKRYSLPSSQIMIHQPLGGFRGQASDIEIHAKNILRIKDRLNKVLAHHTGQDLETIVKDTDRDNFMMADEAKAYGLIDHVIESREAIIK

>5G1Q:B|PDBID|CHAIN|SEQUENCE
MITNNLVPTVIEKTAGGERAFDIYSRLLKERIVFLNGEVNDHSANLVIAQLLFLESEDPDKDIYFYINSPGGMVTAGMGVYDTMQFIKPDVSTICIGLAASMGSLLLAGGAKGKRYSLPSSQIMIHQPLGGFRGQASDIEIHAKNILRIKDRLNKVLAHHTGQDLETIVKDTDRDNFMMADEAKAYGLIDHVIESREAIIK

>5G1Q:C|PDBID|CHAIN|SEQUENCE
MITNNLVPTVIEKTAGGERAFDIYSRLLKERIVFLNGEVNDHSANLVIAQLLFLESEDPDKDIYFYINSPGGMVTAGMGVYDTMQFIKPDVSTICIGLAASMGSLLLAGGAKGKRYSLPSSQIMIHQPLGGFRGQASDIEIHAKNILRIKDRLNKVLAHHTGQDLETIVKDTDRDNFMMADEAKAYGLIDHVIESREAIIK

>5G1Q:D|PDBID|CHAIN|SEQUENCE
MITNNLVPTVIEKTAGGERAFDIYSRLLKERIVFLNGEVNDHSANLVIAQLLFLESEDPDKDIYFYINSPGGMVTAGMGVYDTMQFIKPDVSTICIGLAASMGSLLLAGGAKGKRYSLPSSQIMIHQPLGGFRGQASDIEIHAKNILRIKDRLNKVLAHHTGQDLETIVKDTDRDNFMMADEAKAYGLIDHVIESREAIIK

>5G1Q:E|PDBID|CHAIN|SEQUENCE
MITNNLVPTVIEKTAGGERAFDIYSRLLKERIVFLNGEVNDHSANLVIAQLLFLESEDPDKDIYFYINSPGGMVTAGMGVYDTMQFIKPDVSTICIGLAASMGSLLLAGGAKGKRYSLPSSQIMIHQPLGGFRGQASDIEIHAKNILRIKDRLNKVLAHHTGQDLETIVKDTDRDNFMMADEAKAYGLIDHVIESREAIIK

>5G1Q:F|PDBID|CHAIN|SEQUENCE
MITNNLVPTVIEKTAGGERAFDIYSRLLKERIVFLNGEVNDHSANLVIAQLLFLESEDPDKDIYFYINSPGGMVTAGMGVYDTMQFIKPDVSTICIGLAASMGSLLLAGGAKGKRYSLPSSQIMIHQPLGGFRGQASDIEIHAKNILRIKDRLNKVLAHHTGQDLETIVKDTDRDNFMMADEAKAYGLIDHVIESREAIIK

>5G1Q:G|PDBID|CHAIN|SEQUENCE
MITNNLVPTVIEKTAGGERAFDIYSRLLKERIVFLNGEVNDHSANLVIAQLLFLESEDPDKDIYFYINSPGGMVTAGMGVYDTMQFIKPDVSTICIGLAASMGSLLLAGGAKGKRYSLPSSQIMIHQPLGGFRGQASDIEIHAKNILRIKDRLNKVLAHHTGQDLETIVKDTDRDNFMMADEAKAYGLIDHVIESREAIIK

*length of your protein in Amino Acids: 1428 residues - Just show for 1 chain - Dr. B
Molecular Weight of your protein in kiloDaltons using the Expasy ProtParam website: 154.95 kDa Just show for 1 chain - Dr. B

Molar Extinction coefficient of your protein at 280 nm wavelength: 62955 M-1 cm-1
TMpred graph Image (http://www.ch.embnet.org/software/TMPRED_form.html). Input your amino acid sequence to it. - Just show for 1 chain - Dr. B

TMpredCLPp.gif
TMpredCLPp.gif

*CDS Gene Sequence (paste as text only):
ATGTGGCCCAGAGTGCTGCTGGGGGAGGCCCGGGTGGCTGTGGACGGATGTCGCGCTCTGTTGTCTCGCC

TTGCCGTGCATTTCTCCCCGCCATGGACTGCTGTGAGCTGCTCACCCCTGCGGAGGAGCCTGCATGGAAC

TGCGACGCGAGCTTTCCCGCTCATCCCCATAGTGGTGGAGCAGACGGGTCGAGGCGAGCGCGCTTATGAC

ATATACTCGAGGCTGTTGCGGGAACGCATCGTGTGCGTCATGGGCCCGATTGACGACAGTGTGGCCAGTC

TGGTCATTGCCCAGCTGTTGTTCTTACAGTCTGAAAGCAACAAGAAGCCCATTCATATGTATATCAACAG

CCCAGGTGGTGTGGTAACTGCGGGCCTGGCCATCTACGACACAATGCAGTACATCCTGAACCCCATCTGC

ACGTGGTGTGTTGGACAGGCTGCCAGCATGGGCTCCCTGCTCCTCGCTGCTGGCAGCCCGGGCATGCGCC

ATTCACTGCCCAATTCCAGAATCATGATCCACCAGCCCTCTGGAGGAGCCAGGGGCCAAGCCACAGACAT

CGCCATCCAGGCAGAGGAAATCATGAAGCTGAAAAAGCAGCTATACAACATCTACGCCAAACACACCAAG

CAGAGCCTACAGGTGATCGAGTCAGCAATGGAGAGGGACCGCTACATGAGCCCCATGGAGGCCCAAGAGT

TTGGCATCTTGGACAAGGTCTTGGTCCACCCACCTCAGGACGGGGAGGATGAGCCAGAACTGGTACAGAA

GGAGACTGCCACAGCGCCGACGGATCCTCCTGCCCCGACAAGCACCTAA
*GC% Content for gene: 58.73%


Do Not Need this info for Spring (but still copy these lines to your Target page for now)

output

*GC% Content for gene (codon optimized):

Primer design results for pNIC-Bsa4 cloning (list seqeunces of all of your ~40 nt long primers):
(link to DNA Works output text file - that should be saved in your Google Docs folder after you did the primer design protocol)
-- Ask a mentor, Dr. B, or a fellow researcher -how to link a GDocs file if you are not sure how to.

Primer design results for 'tail' primers (this is just 2 sequences):
**
Links:


Stress Tolerance and Infection NCBI
Open and Closed Conformations