Summer 2017 Target Discovery

Revivals

Not Cloned yet
TargetF15 - S-adenosylmethionine Synthetase (Mycobacterium tuberuclosis)....................................Bethany R., Ana R. Su17 - Alexandra B, Haoyi W, Parthavi M, Marcus H.
TargetF15 - D-alanine Ligase (Listeria monocytogenes).....................................................................Simone M. Su17 - Edd E., Esther J., Zohair A
TargetF15 - 6-phosphoglucanate dehydrogenase, decarboxylating, putative (Trypanosoma cruzi)...Diane C. Su17 - Kaan K, Sung-Hoon P, Patricia B,

TargetF15- 6-phosphogluconate dehydrogenase, decarboxylating, putative (Leishmania major)....Mayur P.
TargetF15 - S-adenosylmethionine Synthetase (Burkholderia pseudomallei)......................................Matthew N., Justin H.
Target - Protein Tyrosine Phosphatase (Listeria monocytogenes) ------- Akhilesh, Mihir, Shane



New
D-alanine ligase (Yersinia pestis)........................................................................................Su17 - Rosa J, Allison P, Nihitha
6-phosphoglucanate dehydrogenase (//T. gondii//)................................................................... Su17 - Quynh (Megan) L, Orlando, Shaochen (Tiger) Y




Not used
D-alanine ligase (//K. pneumoniae//).........................................................................................Tiger Y.- not enough info for a target
6-phosphoglucanate dehydrogenase (//L. monocytogenes//)...................................................Kaan K.- Not enough info on essentiality

Target -1-deoxy-D-xylulose 5-phosphate reductoisomerase (Francisella Tularensis)----------Janice, Aldo



TargetSp17 - NH3-dependent NAD synthetase (Clostridium botulinum)....Brian H. - good Dr B - No, is an Octamer. - DR. B


http://www.rcsb.org/pdb/explore/explore.do?structureId=5BPF

ARI
RpFabG - Aparna
Geovanny - EhPTP & 6-phosphoglucanate dehydrogenase (P. vivax)
Tu - KPC-2 & ?
Lizzie - MtDalaDala
Nura - EhPTP & ??

Possibles for ARI (cloned into vector already):
Target - 6-phosphoglucanate dehydrogenase (P. vivax).............................................Nikki W., Carolyn T, ARI-Sp16: Cindy N.
Target- 6-phosphogluconate dehydrogenase (T. brucei).............................................................(Created by Emily J.) Researchers: Kavya K. and Vicky G. ARI-Sp16: Sam D.
Target - 1-deoxy-D-xylulose-5-phosphate reductoisomerase (P. falciparum)---------------------Kaarthik, Andrew, Alex
IMP-7: (metal-dependent), pET-28b, His Tag


Spring & Summer 2017 Target Selection Pages


New Targets:
Good:





Okay:

Bad:





PART 1:

TDR Targets Searches Exercise (for practice)


PURPOSE:

find genes for these criteria using the TDR Targets webpage and then enter them onto spreadsheet:

  • Pick a search, Perform the search, See which targets are found in the list.
  • If the target is already on the spreadsheet - go to the next one that hasn't been entered yet.
  • Put your name down in the 'SOURCE / PI' column for that target and fill in the rest of the information

Phosphatases in T. brucei that have no transmembrane regions, have essentiality evidence, and are druggable at least to 0.5.
Phosphatases in T. cruzi that have no transmembrane regions, have essentiality evidence, and are druggable at least to 0.5.
Phosphatases in P. falciparum hat have no transmembrane regions, have essentiality evidence, and are druggable at least to 0.5.
Phosphatases in P. vivax that have no transmembrane regions, have essentiality evidence, and are druggable at least to 0.5.
Phosphatases in T. gondii that have no transmembrane regions, have essentiality evidence, and are druggable at least to 0.5.
Phosphatases in M. tuberculosis that have no transmembrane regions, have essentiality evidence, and are druggable at least to 0.5.
Phosphatases in L. major that have no transmembrane regions, have essentiality evidence, and are druggable at least to 0.5.
Reductase in all (except C. elegans) that have no transmembrane regions, have essentiality evidence, and are druggable at least to 0.6 (be sure to search for reductase and check the box for enzyme)



Spreadsheet for TDR Target


https://docs.google.com/spreadsheets/d/1lWqGZUVD0mIoOsmWt5V5lQbXexmM-Iv3eDarxS6S_kk/edit?usp=sharing




PART 2:

SELECTING YOUR TARGET
NOTE: do this ONLY after you have completed the above TDR Targets exercise.
Follow the rest of the Target Discovery Protocol and create a new Wikispaces page that has all the info you need for a target. (the Wikispaces page will link from here)

How To Create a New Target page

Login to Wikispaces, Edit this Targets page with a title that will link to your new page, Type a new line that says:
While still in the editing mode, Highlight the first part of what you just typed (e.g. the part without your name), Click on the 'Link' button above on the toolbar, Click ' New Window' under Page or File, Click 'Add Link'
-- This will create a new page.
-- Save the current page
-- Click on the link to your new page. It will say "This page doesn't exist yet. You can create it by clicking the edit button"
-- Edit the page by copying and pasting the 'Format for Individual Target pages' shown below. Then fill in the respective information for each item....

*NOTE; Do not use "/" in your page titles
Genus and species name should be in italics

"Target - <protein name> <Genus species> ................<your name(s)>"




Spring 2016 Target Selection Pages

ENTER THE LINKS TO YOUR TARGET PAGES HERE
For Example:
TargetSp16 - Dihydrofolate Reductase Klebsiella pneumoniae...................Joe Y.
TargetSp16 - Probable Adenylate Kinase ADK (Mycobacterium tuberculosis) . . . .Safir A.




TargetSp16- 6-phosphogluconate dehydrogenase, decarboxylating, putative Leishmania major ..............Laura L., Naren M
TargetSp16- 6-phosphogluconate dehydrogenase, decarboxylating, putative T. cruzi............. Bella, Elisa P
TargetSp16- S-adenosylmethionine Synthetase //Mycobacterium tuberculosis// ....................Aakash B. , Kelly S, Priya G (Summ17)
TargetSp16- Tyrosine-protein phosphatase CpsB (//Streptococcus pneumoniae)// ...........Justin Kim, Rachel C
TargetSp16- Low Molecular Weight Phosphotyrosine phosphatase (//Vibrio Cholerae)// ......Hailey C., Tommy V





Fall 2016 Targets

TargetSp16- 6-phosphogluconate dehydrogenase, decarboxylating, putative Leishmania major ..............Laura L., Naren M
TargetSp16- 6-phosphogluconate dehydrogenase, decarboxylating, putative T. cruzi............. Bella, Elisa P
TargetSp16- Glutathione reductase (Plasmodium falciparum 3D7)..............Jennifer A, Gayeong
TargetSp16- D-alanine ligase Listeria monocytogenes ............Amy Z, Akhila J, Josue
TargetSp16- S-adenosylmethionine synthetase Burkholderia pseudomallei ........... ???????
TargetSp16- N-acetylneuraminic acid synthase (//Neisseria meningitidis)//........My Q., Shadi
TargetSp16- S-adenosylmethionine Synthetase //Mycobacterium tuberculosis// ....................Aakash B. , Kelly S PriyaG?
TargetSp16- Tyrosine-protein phosphatase CpsB (//Streptococcus pneumoniae)// ...........Justin Kim, Rachel C
TargetSp16- Low Molecular Weight Phosphotyrosine phosphatase (//Vibrio Cholerae)// ......Hailey C., Tommy V

TargetSp16- (FlaB)(Lyme borreliosis). . . .Jeremiah W.
TargetSp16 -sipD (Salmonella invasion protein D) Salmonella typhimurium .... Kelly S.
TargetSp16 - Glucose-6-phosphate dehydrogenase (Plasmodium falciparum)................. Paige M.
TargetSp16 - Beta lactamase class A (staphylococcus aureus) ...........................Maheen S.
TargetSp16- GuaA (Borrelia burgodorferi) . . . .Mandy B.
Target Sp16- AEK1 (//Trypanosoma brucei//).........Shadi D.
Target Sp16-manganese-dependent inorganic pyrophosphatase (Streptococcus agalactiae)....Elisa P.
Target Sp16- Glutathione reductase (Plasmodium falciparum 3D7)....................Jennifer A.
TargetSp16- TbPIP5K1 (phosphatidylinositol 4-phosphate 5-kinase) Trypanosoma brucei...............Tarika S.
TargetSp16-Microcin C7 self-immunity protein MccF (Bacillus anthracis).........Daniella Perez
TargetSp16- Ribosomal RNA Large Subunit Methyltransferase Cfr (//Clostridium botulinum//) ..........Tommy V.

TargetSp16- 4-(cytidine 5' -diphospho)-2-C-methyl-D-erythritol kinase (Bacillus anthracis)..................Areeba K.
TargetSp16- 5-O-(1-carboxyvinyl)-3-phosphoshikimate phosphate-lyase (Campylobacter jejuni)........Aakash B.
TargetSp16- Thioredoxin Reductase (Entamoeba Hystolica) ........ Marissa H.
TargetF15- phospholipase C (clostridium perfrigens).......................................Gayeong L.

TargetSp16- Shiga Toxin subunit B (//Shigella dysenteriae//).............Amy Z.
TargetSp16- Clostripain (Clostridium botulinum) ............Rachel C.
TargetSp16- Fb G 3-ketoacyl-(acyl-carrier-protein) reductase...........Rachna U.

TargetSp16- Serine-threonine protein kinase PknG (Mycobacterium leprae) ................Laura L



ARI Targets (Sp16)

TargetF15 - Klebsiella Pneumoniae Carbapenamase-2 (Klebsiella pneumoniae..............................Jeffrey X.
TargetF15 - Verona-integron encoded Metallo-beta Lactamase (Pseudomonas aeruginosa)............Steven T.
Target - D-alanine:D-alanine Ligase. (M. tuberculosis)..............................................., Chris T. Charina B (VDS, ARI-Sp16)
Target - 6-phosphoglucanate dehydrogenase (P. vivax).............................................Nikki W., Carolyn T, ARI-Sp16: Cindy N.
Target- 6-phosphogluconate dehydrogenase (T. brucei).............................................................(Created by Emily J.) Researchers: Kavya K. and Vicky G. ARI-Sp16: Sam D.

POSSIBLES:
TargetSp13 - Fab G 3-ketoacyl-(acyl-carrier-protein) reductase.(Rickettsia prowazekii)................................RpFabG..........................Researchers: Priya P. Oscar V Betty H - - ARISp16 Ramiro, Aparna

Target - FabG 3-oxoacyl-(acyl-carrier protein) reductase (P. falciparum) .......................... Researchers: Melissa H. & Jason P. - ARISp16: - Nishtha

Target - 3-oxoacyl- (acyl-carrier-protein) reductase (Mycobacterium tuberculosis)............ (Created by Caroline C) Researcher: Grace & Young - ARISp16 - Rayudu

Target-protein tyrosine phosphatase (Entamoeba histolytica).......................EhPTP.............Andee F. (Vicky G.) - ARISp16: Timothy, Brian

NDM-1 http://vdsstream.wikispaces.com/NDM-1+Beta-lactamase+Project ....................... ARISp16: Kyle, Sonia, Sarah, Sabi



++++++++++++++++++++++++++++++++++++++++++++++++++++++


Format for Individual Target pages (copy this list to new Target page and then fill in for your target):

*Target (protein/gene name):
*NCBI Gene # or RefSeq#:
*Protein ID (NP or XP #) or Wolbachia#:
*Organism (including strain):
Etiologic Risk Group (see link below):
*/Disease Information (sort of like the Intro to your Mini Research Write up):
Link to TDR Targets page (if present):
Link to Gene Database page (NCBI, EuPath databases -e.g. TryTryp, PlasmoDB, etc - or PATRIC, etc.)
Essentiality of this protein:
Is it a monomer or multimer as biological unit? (make prediction at http://www.ebi.ac.uk/msd-srv/prot_int/pistart.html):
Complex of proteins?:
Druggable Target (list number or cite evidence from a paper/database showing druggable in another organism):

*EC#:
Link to BRENDA EC# page:
-- Show screenshot of BRENDA enzyme mechanism schematic
Enzyme Assay information (spectrophotometric, coupled assay ?, reagents):
-- link to Sigma (or other company) page for assay (see Sigma links below)
-- -or link (or citation) to paper that contains assay information
-- links to assay reagents (substrates) pages.
--- List cost and quantity of substrate reagents, supplier, and catalog #

Structure (PDB or Homology model)
-- PDB # or closest PDB entry if using homology model:
-- For Homology Model option:
---- Show pairwise alignment of your BLASTP search in NCBI against the PDB
---- Query Coverage:
---- Max % Identities:
---- % Positives
---- Chain used for homology:

Current Inhibitors:
Expression Information (has it been expressed in bacterial cells):
Purification Method:
Image of protein (PyMol with features delineated and shown separately):
*Amino Acid Sequence (paste as text only - not as screenshot or as 'code'):
*length of your protein in Amino Acids
Molecular Weight of your protein in kiloDaltons using the Expasy ProtParam website
Molar Extinction coefficient of your protein at 280 nm wavelength:
TMpred graph Image (http://www.ch.embnet.org/software/TMPRED_form.html). Input your amino acid sequence to it.
*CDS Gene Sequence (paste as text only):
*GC% Content for gene:
*CDS Gene Sequence (codon optimized) - copy from output of Primer Design Protocol (paste as text only):
*GC% Content for gene (codon optimized):

Do Not Need this info for Spring (but still copy these lines to your Target page for now)
Primer design results for pNIC-Bsa4 cloning (list seqeunces of all of your ~40 nt long primers):
(link to DNA Works output text file - that should be saved in your Google Docs folder after you did the primer design protocol)
-- Ask a mentor, Dr. B, or a fellow researcher -how to link a GDocs file if you are not sure how to.

Primer design results for 'tail' primers (this is just 2 sequences):
**





RESOURCES:

See ProtocolTargetDiscoveryVDS.docx for more
Etiologic Risk Group Categories (for pathogens): http://www.utexas.edu/research/rsc/ibc/agent_class.html#_Toc7238334

UT Libraries Page on BIOCHEMISTRY: http://guides.lib.utexas.edu/c.php?g=498744&p=3414807

PlasmoDB: http://plasmodb.org/plasmo/
EuPathDB: http://eupathdb.org/eupathdb/
EnsemblProtists: http://protists.ensembl.org/index.html
GeneDB: http://www.genedb.org/Homepage
Sanger Centre Plasmodium Genome Projects: http://www.sanger.ac.uk/Projects/P_falciparum/
Medicines for Malaria Ventures: http://www.mmv.org
Drugs for Neglected Diseases Initiative: http://www.dndi.org/
The Bill and Melinda Gates Foundation http://www.gatesfoundation.org/Pages/home.aspx
St. Jude Children's Research Hospital: http://www.stjuderesearch.org
Novartis Institute Tropical Disease: http://www.novartis.com/research/nitd/index.shtml
TDR Targets: http://www.tdrtargets.org
ChEMBLdb: http://www.ebi.ac.uk/chembldb
ChEMBL Blog: http://chembl.blogspot.com/
ChEMBL NTD (neglected tropical diseases): https://www.ebi.ac.uk/chemblntd

European PDB info (EMBL-EBI)
http://www.ebi.ac.uk/thornton-srv/databases/cgi-bin/pdbsum/GetPage.pl?pdbcode=1u72&template=ligands.html&l=1.1

Finding Homologous Structures of your protein in the PDB
To find homologous structures - go into the PDB and do an Advanced Search. One of the options on the pull down window on the Advanced Search page is Enzyme Classification. Type in your EC number.
It will give you a list - then narrow that down on the left hand side by other bacterial/protozoan organisms (pick ones that are more taxonomically similar to your organism)
NOTE: this just finds homologous enzymes - but these may not be sufficient for creating a homology model. Need to do BLAST pairwise comparison to determine that.


SIGMA-ALDRICH RESOURCES
Enzyme Explorer
http://www.sigmaaldrich.com/life-science/metabolomics/enzyme-explorer.html

Enzyme Classification Index (EC number)
http://www.sigmaaldrich.com/life-science/biochemicals/biochemical-products.html?TablePage=14573088

Enzyme Explorer Assay Library - has the awesome assays.
http://www.sigmaaldrich.com/life-science/metabolomics/enzyme-explorer/learning-center/assay-library.html



WolframAlpha http://www.wolframalpha.com/
DrugBank http://www.drugbank.ca/


Databases of genes/organisms:
http://www.niaid.nih.gov/Pages/default.aspx
http://eupathdb.org/eupathdb/
https://patricbrc.vbi.vt.edu/portal/portal/patric/Home
http://www.nmpdr.org/FIG/wiki/view.cgi/Main/EssentialGenes
http://tubic.tju.edu.cn/deg/
http://csgid.org/csgid/cake/pages/community_request_gateway
http://tdrtargets.org/
http://gsc.jcvi.org/status.shtml


Scientific Nomenclature page from Center for Disease Control (gene, protein names and abbreviations)
http://wwwnc.cdc.gov/eid/pages/scientific-nomenclature.htm


Gene Information:
NCBI GENE Page: http://www.ncbi.nlm.nih.gov/gene
BLAST Page: http://blast.ncbi.nlm.nih.gov/

Protein Information:
NCBI Protein Page: http://www.ncbi.nlm.nih.gov/protein
Protein Expression Website
Protein Expression Paper: SGC_ProteinProductionPurificationNatMethods2008.pdf


Primer Overlap PCR Articles
HooverLubkowski_PCRoverlapcloninggnf042.pdf
StemmerPCRoverlapGene1995.pdf

Is my target good for Virtual Screening programs?
Reynolds_THermodynamicsLigandBinding_MedChemLett2011.pdf


UT Libraries Pages

Biomedical Big Data Resource Center
Biochemistry (Bioinformatics and Cheminformatics Tools)













Dr. B

Link to other page
filarial target
Wolbachia target
protozon (A, B, C) list:
  • Cryptosporidium parvum
  • Cyclospora cayatanensis
  • Giardia lamblia
  • Entamoeba histolytica
  • Toxoplasma

White nose bat disease



Seattle Structural Genomics Targets - see my Targets folder.
Anaplasma, Babesia, Bartonella, Borrelia, Brucella, Burkholderia, Coccidioides, Cryptosporidium, Ehrlichia, Encephalitozoon, Entamoeba, Giardia, Mycobacterium, Rickettsia, Salmonella

















ACGCTGGTCGACGAAGGCCGGATCACCCCGGAGGAGGCGCACAGCCACCCGCAACGCTCGTTGATCATGCGGGCGTTGACCGGCCATGAGGTCGAACCGACGCTGACCATGCGAGAAGCCCGCGCCGGTGATCGTTACCTGCTGTGCTCGGACGGGTTGTCCGATCCGGTTAGCGATGAAACTATCCTCGAGGCCCTGCAGATCCCCGAGGTTGCCGAGAGCGCTCACCGCCTCATTGAACTGGCGCTGCGCGGCGGCGGCCCCGACAACGTCACTGTCGTCGTCGCCGACGTCGTCGACTACGACTACGGCCAGACCCAACCGATTCTGGCCGGGGCGGTCTCAGGCGACGACGACCAACTGACCCTGCCCAACACCGCCGCCGGCCGGGCCTCTGCCATCAGCCAGCGCAAGGAGATCGTTAAACGCGTTCCGCCACAGGCCGATACATTCAGTCGGCCACGGTGGTCGGGCCGACGGCTAGCATTCGTTGTCGCACTGGTGACCGTGCTGATGACTGCGGGCCTGCTCATTGGTCGCGCGATCATCCGCAGCAACTACTACGTAGCGGACTACGCCGGCAGCGTGTCCATCATGCGGGGGATTCAAGGGTCGCTACTGGGCATGTCCCTGCACCAGCCTTACCTGATGGGCTGCCTCAGCCCGCGTAACGAGCTGTCGCAGATCAGCTACGGACAGTCTGGGGGCCCTCTCGACTGCCATCTGATGAAACTGGAGGATCTGCGACCGCCGGAGCGCGCACAGGTTCGGGCCGGTCTCCCGGCCGGCACTCTCGATGACGCCATCGGGCAGTTGCGCGAACTGGCGGCCAACTCCCTG
CTGCCGCCTTGCCCGGCGCCGCGTGCCACGTCCCCGCCCGGGCGCCCGGCCCCACCCACCACCAGCGAGACAACCGAACCAAACGTCACCTCCTCGCCAGCCTCTCCATCACCCACCACCTCCGCGCCGGCCCCCACCGGAACTACTCCTGCCATCCCCACGAGTGCCTCCCCGGCAGCGCCCGCGTCGCCGCCGACGCCTTGGCCCGTCACCAGCTCGCCGACGATGGCCGCACTTCCGCCACCCCCGCCTCAGCCGGGCATCGACTGCCGGGCGGCGGCATGA

||
1-deoxy-D-xylulose-5-phosphate reductoisomeraseGene Symbol
alkaline phosphatase