Recent Changes

Wednesday, November 8

  1. page Undergraduate Research Opportunities edited ... CONFERENCES: Undergraduate Re…
    Undergraduate Research Forum (UT-Austin)
    2018, April 13th
    American Society for Biochemistry and Molecular Biology (ASBMB)
    2017 - Chicago
    2018 - San Diego - April 22-25th

    The Protein Society (Summer)
    Texas Academy of Science
    Midland College, March 2-4, 2018
    Tech Undergraduate
    Lubbock, Texas) - March 27, 28th
    ABRCMS (Fall)
    CNS Student Research Fellowships page:
    Texas Academy of Science

    (Society for Advancement of Chicanos/Hispanics and Native Americans in Science.)
    (view changes)
    6:18 pm

Tuesday, November 7

  1. page D-alanine ligase (Yersinia pestis) edited ... Current Inhibitors:…
    Current Inhibitors:
    in E. colicoli.
    Purification Method: Ni-NTA
    Image of Protein:
    (view changes)
    10:47 am
  2. page D-alanine ligase (Yersinia pestis) edited ... Is it a monomer or multimer as biological unit? Multimer Complex of Proteins? D-alanine D-ala…
    Is it a monomer or multimer as biological unit? Multimer
    Complex of Proteins? D-alanine D-alanine ligase consists of three domains, in which four loops, loop 1, loop 2, loop 3 and loop 4, constitute the binding sites for two D-alanine molecules and one ATP molecule.
    another organism):
    Mycobacterium Tuberculosis
    Link to BRENDA EC# page:
    (view changes)
    10:46 am

Tuesday, October 31

  1. page TargetSp17- PP2C- family Ser Thr Phosphatase (Mycobacterium tuberculosis) edited ... -- Ask a mentor, Dr. B, or a fellow researcher -how to link a GDocs file if you are not sure h…
    -- Ask a mentor, Dr. B, or a fellow researcher -how to link a GDocs file if you are not sure how to.
    Primer design results for 'tail' primers (this is just 2 sequences):
    Forward Primer:
    Reverse Primer:

    (view changes)
    6:24 pm
  2. page Target - Protein Tyrosine Phosphatase (Listeria monocytogenes) edited Target (protein/gene (protein / gene name): Protein Protein Tyrosine Phosphatase - lmo1800…

    Target (protein/gene(protein / gene name): ProteinProtein Tyrosine Phosphatase - lmo1800

    * NCBI
    Gene # or RefSeq#: Project:61583, NC_003210.1,RefSeq #: Project: 61583 , NC_003210.1, Gene ID: 985934

    * Protein
    ID (NP
    #) or Wolbachia#:Wolbachia #: NP_465325.1 (use
    B 090313)

    * Organism:
    Listeria monocytogenes

    Risk Group
    below): Risk groupGroup 2 -
    including Chlaymidia

    * Background / Disease
    Information: The most deadlyMost Deadly Born food born pathogen. Induces
    cytosol bacteria maycan reproduce.
    enzymes: No

    * EC #:

    to BRENDA EC#EC # page:

    Assay information (spectrophotometric,(spherophophometrics, coupled assay ?,assay, reagents):

    link to
    reagents (substrates)®ion=US&focuseddocuments&N = 0 + 220003049 + 219853269 + 219853286 & mode = match% 20partialmax

    link to
    that contains assay information:information Assay:

    List of cost and quantity ofQUANTITY substrate reagents and supplier
    Available (PDB
    Homology model) /explore/ - QUERY Coverage (Not exposed to direct match): 84% E value - 8 x 10 ^ -22 Druggable Target (see databases for this): Yes Current Inhibitors: None, http: / / Expression Information: Purification Method: PyMol or other: Homology model with M. tuberculosis: Blastp gives 47% positives and 83 % query query. * Amino Acid Sequence:
    -- Query Coverage (if not direct match): 84%
    E value - 8 x 10^-22
    Druggable Target (see Databases for this): Yes
    Current Inhibitors: None,
    Expression Information (has it been expressed in bacterial cells):
    Purification Method:
    Image of protein (PyMol or etc):
    Homology model with M. tuberculosis: Blastp gives 47% positives and 83% query coverage.
    *Amino Acid Sequence:
    > gi | 16803840 | ref | NP_465325.1 | lmo1800 hypothetical protein lmo1800 [Listeria monocytogenes EGD-e]

    Weight of your protein in your kiloDaltons using
    ProtParam website

    Extinction coefficient
    nm wavelength:

    * CDS
    Gene Sequence:
    > gi | 16802048: c1873620- 1872724
    * GC%
    Content for gene: 37.9%

    * CDS
    Gene Sequence
    *GC% Content
    *% GC content
    for geneGene (codon optimized): 50.9%

    design results
    cloning (list seqeunces of all of your ~40seqeunces ~ 40 nt long primers):primers)
    Oligos Sequencesequence


















    Primers - C. Burns - Underlined is partial nucleotide sequence - middle black are start and stop codons
    ( link
    to DNA
    text file - that-that should be
    did the primerprimary design protocol)

    Ask a
    how to.
    TMpred Output:
    (view changes)
    6:22 pm
  3. page TargetSp17 - Inogranic pyrophosphatase (Burkholderia pseudomallei) edited ... Reverse Primer: 5’ TATCCACCTTTACTGTCATTTTTTGAAGTTCGCAAC 3’ 36_ bp Primers as designed by To…
    Reverse Primer:
    Primers as designed by Todd:
    Forward Primer: 5' TACTTCCAATCCATGTCTTTCTCTAACGTTCCA 3' 33 bp 1.5 mM Mg++ 68.4 C
    Reverse Primer: 5' TATCCACCTTTACTGTCATTTTTTGAAGTTCGCA 3' 34 bp 1.5 mM Mg++ 68.4 C

    (view changes)
    6:21 pm
  4. page Target - Protein Tyrosine Phosphatase (Listeria monocytogenes) edited ... || Lmon_PTP_21 || ATCAACGCAAAATACGGTTCTATGGACAACTTCCTCAAGGAGAAACTGGGTCTGACGGAC || || Lmon_PTP…

    (link to DNA Works output text file - that should be saved in your Google Docs folder after you did the primer design protocol)
    -- Ask a mentor, Dr. B, or a fellow researcher -how to link a GDocs file if you are not sure how to.
    (view changes)
    5:51 pm

Monday, October 30

  1. page TargetSp17 - Inogranic pyrophosphatase (Burkholderia pseudomallei) edited ... (link to DNA Works output text file - that should be saved in your Google Docs folder after yo…
    (link to DNA Works output text file - that should be saved in your Google Docs folder after you did the primer design protocol)
    -- Ask a mentor, Dr. B, or a fellow researcher -how to link a GDocs file if you are not sure how to.
    Primer design results for 'tail' primers (this is just 2 sequences):
    Forward Primer:
    Reverse Primer:

    (view changes)
    6:28 pm
  2. page Undergraduate Research Opportunities edited ... Journal of Student Research Texas Undergraduate Researc…
    Journal of Student Research
    Texas Undergraduate Research Journal (TURJ)

    J Med Chem
    Bioorganic and Medicinal Chemistry Letters
    (view changes)
    6:01 pm

Sunday, October 22

  1. page TargetSp17 - Inogranic pyrophosphatase (Burkholderia pseudomallei) edited ... Current Inhibitors: 4-{2-[3-(2-Amino-a…
    Current Inhibitors:
    4-{2-[3-(2-Amino-acetyl)-thioureido]-ethyl}-benzenesulfonamide; compound with GENERIC INORGANIC NEUTRAL COMPONENT CHEMBL178560 BDBM50171016
    CHEMBL103102 CHEMBL216318 BDBM50037981 Piperidine-1-carboxamidine; compound with GENERIC INORGANIC NEUTRAL COMPONENT
    N-(pyridin-3-ylmethyl)aniline (DB06851)
    5-amino-1-(4-chlorophenyl)-1H-pyrazole-4-carbonitrile (DB07291)

    Expression Information (has it been expressed in bacterial cells): Yes
    Purification Method:
    (view changes)
    8:59 pm
